Gene name |
SPAC17H9.10c |
Gene ID |
48/A11 |
Gene synonyms/obsolete |
ddb1 |
Gene product |
UV damage binding
factor; XP-E family; involved in DNA replication checkpoint;
no apparent Sc ortholog; non-essential; deletion results in
elongated cells; deletion results in nuclear morphology
defects; deletion sensitive to DNA damaging agents |
Entry clone |
Cloned |
ORF length (unspliced) |
3219 |
ORF length (spliced) |
|
Entry clone length |
3219 |
No. of intron |
0 |
Sequence status |
Finished |
Sequence results |
100% match |
Comments |
|
Polymerase used for cloning |
Pyrobest DNA Pol
(TaKaRa) |
Fwd primer name |
SPAC17H9.10.Fd |
Fwd primer SEQ |
AAAAAGCAGGCTCTCATATGACTTATGTTACTTATTT |
Rev primer name |
SPAC17H9.10.Rv |
Rev primer SEQ |
AGAAAGCTGGGTAAGGATGTAGTTTCTCAAGA |
Amino acid length |
1072 |
Molecular weight |
120.6 |
Isoelectric point (calc.) |
5 |
Signal SEQ |
|
No. of transmembrane domain |
|
NLS position (Columbia Univ.
Bioinformatics Center) |
none |
NES motif (
L-x(2,3)-[IVLMF]-x(2,3)-L-x-[LI]) |
LCATVDGSLMI |
Localization (YFP) |
cytosol=nucleus |
Comments for localization |
|
Effect of LMB on protein
localization |
no change |
Microscope used for
observation |
Leica |