| Gene name |
SPCC970.01 |
| Gene ID |
47/F11 |
| Gene synonyms/obsolete |
rad16; rad10; rad20;
swi9 |
| Gene product |
ss DNA endonuclease;
involved in DNA repair; involved in mating-type determination;
involved in nucleotide-excision repair; involved in meiotic
recombination; involved in meiotic gene conversion (required);
ERCC4 domain |
| Entry clone |
Cloned |
| ORF length (unspliced) |
2998 |
| ORF length (spliced) |
2679 |
| Entry clone length |
2998 |
| No. of intron |
7 |
| Sequence status |
Finished |
| Sequence results |
100% match |
| Comments |
|
| Polymerase used for cloning |
Pyrobest DNA Pol
(TaKaRa) |
| Fwd primer name |
SPCC970.01.Fd |
| Fwd primer SEQ |
AAAAAGCAGGCTCTCATATGGAAACAAAGGTTCATTT |
| Rev primer name |
SPCC970.01.Rv |
| Rev primer SEQ |
AGAAAGCTGGGTACTCATAGTCCTTTAACTGT |
| Amino acid length |
892 |
| Molecular weight |
102 |
| Isoelectric point (calc.) |
6.4 |
| Signal SEQ |
|
| No. of transmembrane domain |
|
| NLS position (Columbia Univ.
Bioinformatics Center) |
466 |
| NES motif (
L-x(2,3)-[IVLMF]-x(2,3)-L-x-[LI]) |
LCVIAPGLSL/LSHCLRCLFL/LKLLDTLVL/LTLSFPNLRI |
| Localization (YFP) |
SPB; nuclear dots;
nucleus |
| Comments for localization |
|
| Effect of LMB on protein
localization |
no change |
| Microscope used for
observation |
Leica,
DeltaVision |