Gene name |
SPBC14C8.14c |
Gene ID |
47/E11 |
Gene synonyms/obsolete |
pol5 |
Gene product |
DNA polymerase V |
Entry clone |
Cloned |
ORF length (unspliced) |
2949 |
ORF length (spliced) |
2880 |
Entry clone length |
2949 |
No. of intron |
1 |
Sequence status |
Finished |
Sequence results |
212C:A / 214A:C |
Comments |
|
Polymerase used for cloning |
Pyrobest DNA Pol
(TaKaRa) |
Fwd primer name |
SPBC14C8.14.Fd |
Fwd primer SEQ |
AAAAAGCAGGCTCTCATATGGCTACAAAAACACAATT |
Rev primer name |
SPBC14C8.14.Rv |
Rev primer SEQ |
AGAAAGCTGGGTAATGATTTGTCTTTTCATTT |
Amino acid length |
959 |
Molecular weight |
109.7 |
Isoelectric point (calc.) |
5.4 |
Signal SEQ |
|
No. of transmembrane domain |
|
NLS position (Columbia Univ.
Bioinformatics Center) |
none |
NES motif (
L-x(2,3)-[IVLMF]-x(2,3)-L-x-[LI]) |
none |
Localization (YFP) |
nucleolus>nucleus>cytosol |
Comments for localization |
bright signal |
Effect of LMB on protein
localization |
changed to:
nucleolus>nucleus |
Microscope used for
observation |
Leica |