Gene name |
SPCC613.13c |
Gene ID |
47/D05 |
Gene synonyms/obsolete |
rhp16; rad16;
SPCC330.01c |
Gene product |
involved in DNA
repair; involved in nucleotide-excision repair; zinc finger
protein; zf-C3HC4 type (RING finger); ubiquitin ligase (E3);
SNF2 familyj; DEAD/DEAH box helicase; helicase C-terminal
domain |
Entry clone |
Cloned |
ORF length (unspliced) |
2892 |
ORF length (spliced) |
|
Entry clone length |
2892 |
No. of intron |
0 |
Sequence status |
Finished |
Sequence results |
100% match |
Comments |
|
Polymerase used for cloning |
Pyrobest DNA Pol
(TaKaRa) |
Fwd primer name |
SPCC613.13.Fd |
Fwd primer SEQ |
AAAAAGCAGGCTCTCATATGCATATATCTACTCTAAA |
Rev primer name |
SPCC613.13.Rv |
Rev primer SEQ |
AGAAAGCTGGGTAATTTGAGAACAAGAATTGC |
Amino acid length |
963 |
Molecular weight |
109.3 |
Isoelectric point (calc.) |
5.7 |
Signal SEQ |
|
No. of transmembrane domain |
|
NLS position (Columbia Univ.
Bioinformatics Center) |
288 |
NES motif (
L-x(2,3)-[IVLMF]-x(2,3)-L-x-[LI]) |
none |
Localization (YFP) |
nucleus |
Comments for localization |
|
Effect of LMB on protein
localization |
no change |
Microscope used for
observation |
Leica |