Gene name |
SPAC18G6.02c |
Gene ID |
47/D04 |
Gene synonyms/obsolete |
chp1 |
Gene product |
chromodomain protein;
involved in centromeric silencing (required); involved in
chromosome segregation (required); interacts genetically with
alpha-tubulin; binds centromeric flanking sequence |
Entry clone |
Cloned |
ORF length (unspliced) |
2883 |
ORF length (spliced) |
|
Entry clone length |
2883 |
No. of intron |
0 |
Sequence status |
Finished |
Sequence results |
100% match |
Comments |
|
Polymerase used for cloning |
Pyrobest DNA Pol
(TaKaRa) |
Fwd primer name |
SPAC18G6.02.Fd |
Fwd primer SEQ |
AAAAAGCAGGCTCTCATATGGTATCTGTTAAACCACT |
Rev primer name |
SPAC18G6.02.Rv |
Rev primer SEQ |
AGAAAGCTGGGTATTTTAAACCAATAGCTCTC |
Amino acid length |
960 |
Molecular weight |
108.7 |
Isoelectric point (calc.) |
5.5 |
Signal SEQ |
|
No. of transmembrane domain |
|
NLS position (Columbia Univ.
Bioinformatics Center) |
70/92/118/72 |
NES motif (
L-x(2,3)-[IVLMF]-x(2,3)-L-x-[LI]) |
LTKVLSGSLCI/LLELISPFLEI/LTPVNGLDI |
Localization (YFP) |
SPB; nuclear dots;
nucleus |
Comments for localization |
|
Effect of LMB on protein
localization |
no change |
Microscope used for
observation |
Leica,
DeltaVision |