Gene name |
SPAC4H3.05 |
Gene ID |
47/C06 |
Gene synonyms/obsolete |
srs2 |
Gene product |
UVRD helicase;
ATP-dependent; DNA helicase activity; involved in DNA damage
response; involved in DNA damage resistance; involved in
meiotic recombination; involved in suppression of meiotic
recombination (required); involved in DNA repair; involved in
double-strand break repair |
Entry clone |
Cloned |
ORF length (unspliced) |
2819 |
ORF length (spliced) |
2664 |
Entry clone length |
2819 |
No. of intron |
3 |
Sequence status |
Finished |
Sequence results |
100% match |
Comments |
|
Polymerase used for cloning |
Pyrobest DNA Pol
(TaKaRa) |
Fwd primer name |
SPAC4H3.05.Fd |
Fwd primer SEQ |
AAAAAGCAGGCTCTCATATGGAAACGAAATCATCATA |
Rev primer name |
SPAC4H3.05.Rv |
Rev primer SEQ |
AGAAAGCTGGGTATAACATTCGTGAAACTCGT |
Amino acid length |
887 |
Molecular weight |
101.1 |
Isoelectric point (calc.) |
9.7 |
Signal SEQ |
|
No. of transmembrane domain |
|
NLS position (Columbia Univ.
Bioinformatics Center) |
none |
NES motif (
L-x(2,3)-[IVLMF]-x(2,3)-L-x-[LI]) |
LADFDDLLL |
Localization (YFP) |
SPB; nuclear dots;
nucleus; spindle microtubules? |
Comments for localization |
|
Effect of LMB on protein
localization |
no change |
Microscope used for
observation |
DeltaVision |