Gene name |
SPAC16C9.06c |
Gene ID |
47/C03 |
Gene synonyms/obsolete |
|
Gene product |
involved in mRNA
catabolism, nonsense-mediated; regulator of nonsense
transcript stability; involved in mRNA decapping (regulation);
RNA dependent ATP helicase; DNA2/NAM7 family |
Entry clone |
Cloned |
ORF length (unspliced) |
2778 |
ORF length (spliced) |
|
Entry clone length |
2778 |
No. of intron |
0 |
Sequence status |
Finished |
Sequence results |
100% match |
Comments |
|
Polymerase used for cloning |
Pyrobest DNA Pol
(TaKaRa) |
Fwd primer name |
SPAC16C9.06.Fd |
Fwd primer SEQ |
AAAAAGCAGGCTCTCATATGTCTTTAGGGCTACAACC |
Rev primer name |
SPAC16C9.06.Rv |
Rev primer SEQ |
AGAAAGCTGGGTAGAACCTAGTAGGTTCGTCG |
Amino acid length |
925 |
Molecular weight |
104.5 |
Isoelectric point (calc.) |
8.4 |
Signal SEQ |
|
No. of transmembrane domain |
|
NLS position (Columbia Univ.
Bioinformatics Center) |
435/437 |
NES motif (
L-x(2,3)-[IVLMF]-x(2,3)-L-x-[LI]) |
LSQSLFERLII |
Localization (YFP) |
cytosol |
Comments for localization |
|
Effect of LMB on protein
localization |
changed to:
cytosol=nucleus |
Microscope used for
observation |
Leica |