Gene name |
SPCC16A11.12c |
Gene ID |
47/C02 |
Gene synonyms/obsolete |
ubp1 |
Gene product |
ubiquitin C-terminal
hydrolase activity |
Entry clone |
Cloned; Mixture |
ORF length (unspliced) |
2775 |
ORF length (spliced) |
2550 |
Entry clone length |
2775 |
No. of intron |
1 |
Sequence status |
Finished |
Sequence results |
Mixture |
Comments |
|
Polymerase used for cloning |
Pyrobest DNA Pol
(TaKaRa) |
Fwd primer name |
SPCC16A11.12.Fd |
Fwd primer SEQ |
AAAAAGCAGGCTCTCATATGGCATCAACTGCTACTCA |
Rev primer name |
SPCC16A11.12.Rv |
Rev primer SEQ |
AGAAAGCTGGGTAATTCTTTGCTCTGTAAAAC |
Amino acid length |
849 |
Molecular weight |
98.6 |
Isoelectric point (calc.) |
5.6 |
Signal SEQ |
|
No. of transmembrane domain |
|
NLS position (Columbia Univ.
Bioinformatics Center) |
749/740 |
NES motif (
L-x(2,3)-[IVLMF]-x(2,3)-L-x-[LI]) |
none |
Localization (YFP) |
no apparent
signal |
Comments for localization |
|
Effect of LMB on protein
localization |
not determined |
Microscope used for
observation |
Leica |