Gene name |
SPBC24C6.09c |
Gene ID |
46/H07 |
Gene synonyms/obsolete |
|
Gene product |
transketolase; similar
to Synechocystis sp. P74690; phosphotransacetylase; bacterial
enzyme splits fructose-6-P and/or xylulose-5-P with the aid of
inorganic phosphate into either acetyl-P and erythrose-4-P
and/or acetyl-P and glyeraldehyde-3-P; no apparent Sc
ortholog |
Entry clone |
Cloned; Mixture |
ORF length (unspliced) |
2478 |
ORF length (spliced) |
|
Entry clone length |
2478 |
No. of intron |
0 |
Sequence status |
Finished |
Sequence results |
100% match |
Comments |
|
Polymerase used for cloning |
Pyrobest DNA Pol
(TaKaRa) |
Fwd primer name |
SPBC24C6.09.Fd |
Fwd primer SEQ |
AAAAAGCAGGCTCTCATATGGCTACTCAAAACGATAT |
Rev primer name |
SPBC24C6.09.Rv |
Rev primer SEQ |
AGAAAGCTGGGTATAATGTGGAAGTCTTATTT |
Amino acid length |
825 |
Molecular weight |
92.5 |
Isoelectric point (calc.) |
6.4 |
Signal SEQ |
|
No. of transmembrane domain |
|
NLS position (Columbia Univ.
Bioinformatics Center) |
none |
NES motif (
L-x(2,3)-[IVLMF]-x(2,3)-L-x-[LI]) |
none |
Localization (YFP) |
cytosol=nucleus |
Comments for localization |
except nucleolus |
Effect of LMB on protein
localization |
no change |
Microscope used for
observation |
Confocal |