Gene name |
SPAC3A12.06c |
Gene ID |
46/G06 |
Gene synonyms/obsolete |
|
Gene product |
putative membrane
transport protein; CaCA sodium/calcium exchanger |
Entry clone |
Cloned |
ORF length (unspliced) |
2232 |
ORF length (spliced) |
|
Entry clone length |
2232 |
No. of intron |
0 |
Sequence status |
Finished |
Sequence results |
100% match |
Comments |
|
Polymerase used for cloning |
Pyrobest DNA Pol
(TaKaRa) |
Fwd primer name |
SPAC3A12.06.Fd |
Fwd primer SEQ |
AAAAAGCAGGCTCTCATATGTCGAAAACTTCATGTTT |
Rev primer name |
SPAC3A12.06.Rv |
Rev primer SEQ |
AGAAAGCTGGGTATTTGTCTTTAAGTAGCTCA |
Amino acid length |
743 |
Molecular weight |
82.3 |
Isoelectric point (calc.) |
6.8 |
Signal SEQ |
Predicted
(N-terminus) |
No. of transmembrane domain |
13 |
NLS position (Columbia Univ.
Bioinformatics Center) |
none |
NES motif (
L-x(2,3)-[IVLMF]-x(2,3)-L-x-[LI]) |
LILLWCILGI/LVTISWLLQL/LRSLDPLNI/LLACLLLLLI/LGLLLFILYI |
Localization (YFP) |
ER |
Comments for localization |
|
Effect of LMB on protein
localization |
no change |
Microscope used for
observation |
Leica |