Gene name |
SPBC11C11.02 |
Gene ID |
46/G01 |
Gene synonyms/obsolete |
imp2 |
Gene product |
involved in
contractile ring assembly; non-essential; involved in
cytokinesis; FCH domain; src (SH3) homology domain; similar to
Sp SPAC20G8.05C; involved in septation (required) |
Entry clone |
Cloned |
ORF length (unspliced) |
2220 |
ORF length (spliced) |
2013 |
Entry clone length |
2220 |
No. of intron |
3 |
Sequence status |
Finished |
Sequence results |
100% match |
Comments |
|
Polymerase used for cloning |
Pyrobest DNA Pol
(TaKaRa) |
Fwd primer name |
SPBC11C11.02.Fd |
Fwd primer SEQ |
AAAAAGCAGGCTCTCATATGTCTCAACAATTAAGCTT |
Rev primer name |
SPBC11C11.02.Rv |
Rev primer SEQ |
AGAAAGCTGGGTAAACCTCGATTTCACGAACA |
Amino acid length |
670 |
Molecular weight |
75.1 |
Isoelectric point (calc.) |
6.5 |
Signal SEQ |
|
No. of transmembrane domain |
|
NLS position (Columbia Univ.
Bioinformatics Center) |
none |
NES motif (
L-x(2,3)-[IVLMF]-x(2,3)-L-x-[LI]) |
none |
Localization (YFP) |
cytosol; cytoplasmic
dots, especially at cell tip |
Comments for localization |
|
Effect of LMB on protein
localization |
no change |
Microscope used for
observation |
Leica |