Gene name |
SPCC364.04c |
Gene ID |
46/C10 |
Gene synonyms/obsolete |
|
Gene product |
CASP family protein; 1
predicted transmembrane helix |
Entry clone |
Cloned
(Re-cloned) |
ORF length (unspliced) |
2025 |
ORF length (spliced) |
1902 |
Entry clone length |
2025 |
No. of intron |
2 |
Sequence status |
Finished |
Sequence results |
100% match |
Comments |
|
Polymerase used for cloning |
Pyrobest DNA Pol
(TaKaRa) |
Fwd primer name |
SPCC364.04.Fd |
Fwd primer SEQ |
AAAAAGCAGGCTCTCATATGGCAGTTGCTTCAGAAGC |
Rev primer name |
SPCC364.04.Rv |
Rev primer SEQ |
AGAAAGCTGGGTAATAATTCATAGGAGTATAT |
Amino acid length |
633 |
Molecular weight |
72.1 |
Isoelectric point (calc.) |
5.2 |
Signal SEQ |
|
No. of transmembrane domain |
1 |
NLS position (Columbia Univ.
Bioinformatics Center) |
none |
NES motif (
L-x(2,3)-[IVLMF]-x(2,3)-L-x-[LI]) |
LGEMKGLLKL/LFIMIVLLKL |
Localization (YFP) |
no transformant |
Comments for localization |
|
Effect of LMB on protein
localization |
not determined |
Microscope used for
observation |
|