Gene name |
SPBC1289.01c |
Gene ID |
46/B04 |
Gene synonyms/obsolete |
SPBC1539.11c |
Gene product |
putative involvement
in chitin biosynthesis; bChs Four Homologue; chitin synthase
regulatory factor; SEL1 repeat protein; similar to Sp
SPBC24B11.10C and SPCC417.05C and SPBC3E7.12C |
Entry clone |
Cloned |
ORF length (unspliced) |
1902 |
ORF length (spliced) |
|
Entry clone length |
1902 |
No. of intron |
0 |
Sequence status |
Finished |
Sequence results |
100% match |
Comments |
|
Polymerase used for cloning |
Pyrobest DNA Pol
(TaKaRa) |
Fwd primer name |
SPBC1289.01.Fd |
Fwd primer SEQ |
AAAAAGCAGGCTCTCATATGGATTCAGCATCTTCTAT |
Rev primer name |
SPBC1289.01.Rv |
Rev primer SEQ |
AGAAAGCTGGGTAAGATATAATACACTTGTTA |
Amino acid length |
633 |
Molecular weight |
70 |
Isoelectric point (calc.) |
4.8 |
Signal SEQ |
|
No. of transmembrane domain |
|
NLS position (Columbia Univ.
Bioinformatics Center) |
none |
NES motif (
L-x(2,3)-[IVLMF]-x(2,3)-L-x-[LI]) |
none |
Localization (YFP) |
nucleus>cytosol;
periphery at site of septum formation |
Comments for localization |
|
Effect of LMB on protein
localization |
changed to:
nucleus>>cytosol; periphery at site of septum
formation |
Microscope used for
observation |
Leica |