| Gene name |
SPBC1289.01c |
| Gene ID |
46/B04 |
| Gene synonyms/obsolete |
SPBC1539.11c |
| Gene product |
putative involvement
in chitin biosynthesis; bChs Four Homologue; chitin synthase
regulatory factor; SEL1 repeat protein; similar to Sp
SPBC24B11.10C and SPCC417.05C and SPBC3E7.12C |
| Entry clone |
Cloned |
| ORF length (unspliced) |
1902 |
| ORF length (spliced) |
|
| Entry clone length |
1902 |
| No. of intron |
0 |
| Sequence status |
Finished |
| Sequence results |
100% match |
| Comments |
|
| Polymerase used for cloning |
Pyrobest DNA Pol
(TaKaRa) |
| Fwd primer name |
SPBC1289.01.Fd |
| Fwd primer SEQ |
AAAAAGCAGGCTCTCATATGGATTCAGCATCTTCTAT |
| Rev primer name |
SPBC1289.01.Rv |
| Rev primer SEQ |
AGAAAGCTGGGTAAGATATAATACACTTGTTA |
| Amino acid length |
633 |
| Molecular weight |
70 |
| Isoelectric point (calc.) |
4.8 |
| Signal SEQ |
|
| No. of transmembrane domain |
|
| NLS position (Columbia Univ.
Bioinformatics Center) |
none |
| NES motif (
L-x(2,3)-[IVLMF]-x(2,3)-L-x-[LI]) |
none |
| Localization (YFP) |
nucleus>cytosol;
periphery at site of septum formation |
| Comments for localization |
|
| Effect of LMB on protein
localization |
changed to:
nucleus>>cytosol; periphery at site of septum
formation |
| Microscope used for
observation |
Leica |