Gene name |
SPAC7D4.10 |
Gene ID |
46/B03 |
Gene synonyms/obsolete |
vma13 |
Gene product |
vacuolar ATP synthase
(subunit H); V-type ATPase (H subunit); vacuolar proton pump
component; V1 sector; di-leucine-binding domain possibly
consists of a HEAT or ARM repeat protein fold |
Entry clone |
Cloned |
ORF length (unspliced) |
1901 |
ORF length (spliced) |
1353 |
Entry clone length |
1901 |
No. of intron |
5 |
Sequence status |
Finished |
Sequence results |
100% match |
Comments |
|
Polymerase used for cloning |
Pyrobest DNA Pol
(TaKaRa) |
Fwd primer name |
SPAC7D4.10.Fd |
Fwd primer SEQ |
AAAAAGCAGGCTCTCATATGTCAAATAGTGATTTAGA |
Rev primer name |
SPAC7D4.10.Rv |
Rev primer SEQ |
AGAAAGCTGGGTATAAAGTAATTTTACTTAGG |
Amino acid length |
450 |
Molecular weight |
51.4 |
Isoelectric point (calc.) |
5.2 |
Signal SEQ |
|
No. of transmembrane domain |
|
NLS position (Columbia Univ.
Bioinformatics Center) |
none |
NES motif (
L-x(2,3)-[IVLMF]-x(2,3)-L-x-[LI]) |
none |
Localization (YFP) |
no apparent
signal |
Comments for localization |
|
Effect of LMB on protein
localization |
not determined |
Microscope used for
observation |
Leica |