Gene name |
SPCC737.03c |
Gene ID |
46/A04 |
Gene synonyms/obsolete |
|
Gene product |
hypothetical protein;
similar to N. crassa NCU03345.1; no apparent Sc ortholog
|
Entry clone |
Cloned |
ORF length (unspliced) |
1848 |
ORF length (spliced) |
|
Entry clone length |
1848 |
No. of intron |
0 |
Sequence status |
Finished |
Sequence results |
1836A:deletion /
1837A:deletion / 1838A:deletion |
Comments |
1 aa deletion |
Polymerase used for cloning |
Pyrobest DNA Pol
(TaKaRa) |
Fwd primer name |
SPCC737.03.Fd |
Fwd primer SEQ |
AAAAAGCAGGCTCTCATATGGAATCTAGCCGATTGTT |
Rev primer name |
SPCC737.03.Rv |
Rev primer SEQ |
AGAAAGCTGGGTAAGCCACCTTTCTTAAAGGA |
Amino acid length |
615 |
Molecular weight |
70.4 |
Isoelectric point (calc.) |
8.6 |
Signal SEQ |
|
No. of transmembrane domain |
6 |
NLS position (Columbia Univ.
Bioinformatics Center) |
none |
NES motif (
L-x(2,3)-[IVLMF]-x(2,3)-L-x-[LI]) |
LPDGIRNLFL/LIIRLTCLYL/LESHFSKSLAL/LLIAFTILFL |
Localization (YFP) |
ER with
discontinuity |
Comments for localization |
|
Effect of LMB on protein
localization |
no change |
Microscope used for
observation |
Leica |