Gene name |
SPAC1782.09c |
Gene ID |
45/E07 |
Gene synonyms/obsolete |
flp1; clp1 |
Gene product |
Cdc14-related protein
phosphatase Clp1/Flp1; non-essential; regulates coordination
of cytokinesis with cell cycle progression; functionally
complemented by human CDC14; phosphoprotein; undergoes
nucleocytoplasmic shuttling |
Entry clone |
Cloned#/Sequence
mismatch |
ORF length (unspliced) |
1669 |
ORF length (spliced) |
1614 |
Entry clone length |
1669 |
No. of intron |
1 |
Sequence status |
Finished |
Sequence results |
439T:deletion/
732A:G |
Comments |
|
Polymerase used for cloning |
Pyrobest DNA Pol
(TaKaRa) |
Fwd primer name |
SPAC1782.09.Fd |
Fwd primer SEQ |
AAAAAGCAGGCTCTCATATGGATTACCAAGATGATGG |
Rev primer name |
SPAC1782.09.Rv |
Rev primer SEQ |
AGAAAGCTGGGTAAGAAATTAGCCGGCTTTTA |
Amino acid length |
537 |
Molecular weight |
60.2 |
Isoelectric point (calc.) |
9.1 |
Signal SEQ |
|
No. of transmembrane domain |
|
NLS position (Columbia Univ.
Bioinformatics Center) |
none |
NES motif (
L-x(2,3)-[IVLMF]-x(2,3)-L-x-[LI]) |
none |
Localization (YFP) |
SPB; nucleus |
Comments for localization |
nuclear dots by over
expression |
Effect of LMB on protein
localization |
no change |
Microscope used for
observation |
DeltaVision |