Gene name |
SPAC1F8.01 |
Gene ID |
45/E06 |
Gene synonyms/obsolete |
ght3 |
Gene product |
hexose transporter;
similar to Sp GHT1 and GHT2 and GHT4 and GHT5 and GHT6 and
SPCC548.06C and SPBC1348.14C |
Entry clone |
Cloned |
ORF length (unspliced) |
1668 |
ORF length (spliced) |
|
Entry clone length |
1668 |
No. of intron |
0 |
Sequence status |
Finished |
Sequence results |
100% match |
Comments |
|
Polymerase used for cloning |
Pyrobest DNA Pol
(TaKaRa) |
Fwd primer name |
SPAC1F8.01.Fd |
Fwd primer SEQ |
AAAAAGCAGGCTCTCATATGAATAGGTTTATTACATC |
Rev primer name |
SPAC1F8.01.Rv |
Rev primer SEQ |
AGAAAGCTGGGTAGATATACGTAGGGTGTGAA |
Amino acid length |
555 |
Molecular weight |
62 |
Isoelectric point (calc.) |
8.4 |
Signal SEQ |
Predicted
(N-terminus) |
No. of transmembrane domain |
12 |
NLS position (Columbia Univ.
Bioinformatics Center) |
none |
NES motif (
L-x(2,3)-[IVLMF]-x(2,3)-L-x-[LI]) |
LLMVGVLFL |
Localization (YFP) |
periphery |
Comments for localization |
except cell tip and
site of septum formation |
Effect of LMB on protein
localization |
no change |
Microscope used for
observation |
Leica,
DeltaVision |