Gene name |
SPAC13G7.05 |
Gene ID |
45/D03 |
Gene synonyms/obsolete |
|
Gene product |
acyl-coA-sterol
acyltransferase |
Entry clone |
Cloned; Mixture |
ORF length (unspliced) |
1614 |
ORF length (spliced) |
|
Entry clone length |
1614 |
No. of intron |
0 |
Sequence status |
Finished |
Sequence results |
Mixture of 45/D03 and
45/D04 |
Comments |
|
Polymerase used for cloning |
Pyrobest DNA Pol
(TaKaRa) |
Fwd primer name |
SPAC13G7.05.Fd |
Fwd primer SEQ |
AAAAAGCAGGCTCTCATATGACAGATACTCCTAGGAT |
Rev primer name |
SPAC13G7.05.Rv |
Rev primer SEQ |
AGAAAGCTGGGTAAAAGACAATGTATAAGATA |
Amino acid length |
537 |
Molecular weight |
63 |
Isoelectric point (calc.) |
9.4 |
Signal SEQ |
|
No. of transmembrane domain |
7 |
NLS position (Columbia Univ.
Bioinformatics Center) |
none |
NES motif (
L-x(2,3)-[IVLMF]-x(2,3)-L-x-[LI]) |
LDFIGKLRI |
Localization (YFP) |
ER |
Comments for localization |
|
Effect of LMB on protein
localization |
no change |
Microscope used for
observation |
Leica |