Gene name |
SPAC31A2.09c |
Gene ID |
44/F07 |
Gene synonyms/obsolete |
apm4 |
Gene product |
clathrin coat assembly
protein; AP adaptor complex; involved in vesicle-mediated
protein transport |
Entry clone |
Cloned |
ORF length (unspliced) |
1437 |
ORF length (spliced) |
1341 |
Entry clone length |
1437 |
No. of intron |
2 |
Sequence status |
Finished |
Sequence results |
100% match |
Comments |
|
Polymerase used for cloning |
Pyrobest DNA Pol
(TaKaRa) |
Fwd primer name |
SPAC31A2.09.Fd |
Fwd primer SEQ |
AAAAAGCAGGCTCTCATATGATTTCGGTTAGTATTAA |
Rev primer name |
SPAC31A2.09.Rv |
Rev primer SEQ |
AGAAAGCTGGGTAAATGCGTATCTCGCAAGTT |
Amino acid length |
446 |
Molecular weight |
50.8 |
Isoelectric point (calc.) |
9.5 |
Signal SEQ |
|
No. of transmembrane domain |
|
NLS position (Columbia Univ.
Bioinformatics Center) |
none |
NES motif (
L-x(2,3)-[IVLMF]-x(2,3)-L-x-[LI]) |
none |
Localization (YFP) |
SPB; spindle
microtubules; periphery at site of septum formation;
nucleus>>cytosol |
Comments for localization |
|
Effect of LMB on protein
localization |
no change |
Microscope used for
observation |
DeltaVision |