Gene name |
SPAC23D3.03c |
Gene ID |
44/E08 |
Gene synonyms/obsolete |
|
Gene product |
GTPase activating
protein of Rab-like GTPase; TBC domain protein; no apparent Sc
ortholog; similar to D. dictyostelium drainin |
Entry clone |
Cloned |
ORF length (unspliced) |
1419 |
ORF length (spliced) |
|
Entry clone length |
1419 |
No. of intron |
0 |
Sequence status |
Finished |
Sequence results |
100% match |
Comments |
|
Polymerase used for cloning |
Pyrobest DNA Pol
(TaKaRa) |
Fwd primer name |
SPAC23D3.03.Fd |
Fwd primer SEQ |
AAAAAGCAGGCTCTCATATGGAATCATTAGAAAGTGT |
Rev primer name |
SPAC23D3.03.Rv |
Rev primer SEQ |
AGAAAGCTGGGTAAGATAGTGATATATCGTAT |
Amino acid length |
472 |
Molecular weight |
54.3 |
Isoelectric point (calc.) |
7.5 |
Signal SEQ |
|
No. of transmembrane domain |
|
NLS position (Columbia Univ.
Bioinformatics Center) |
none |
NES motif (
L-x(2,3)-[IVLMF]-x(2,3)-L-x-[LI]) |
LATHLLIKLEL |
Localization (YFP) |
Golgi |
Comments for localization |
|
Effect of LMB on protein
localization |
no change |
Microscope used for
observation |
DeltaVision |