| Gene name |
SPCC330.08 |
| Gene ID |
44/E07 |
| Gene synonyms/obsolete |
arg11; gmd3 |
| Gene product |
putative glycosyl
transferaseglycosyl transferase family 1; possibly involved in
N-linked oligosacchadride synthesis; involved in glycosylation
of acid phosphatase; functionally complements Sc ALG11 |
| Entry clone |
Cloned |
| ORF length (unspliced) |
1416 |
| ORF length (spliced) |
|
| Entry clone length |
1416 |
| No. of intron |
0 |
| Sequence status |
Finished |
| Sequence results |
829C:T |
| Comments |
|
| Polymerase used for cloning |
Pyrobest DNA Pol
(TaKaRa) |
| Fwd primer name |
SPCC330.08.Fd |
| Fwd primer SEQ |
AAAAAGCAGGCTCTCATATGATTACAACACTTGCCAT |
| Rev primer name |
SPCC330.08.Rv |
| Rev primer SEQ |
AGAAAGCTGGGTAGGTACGACTGTAATCTTCA |
| Amino acid length |
471 |
| Molecular weight |
53.2 |
| Isoelectric point (calc.) |
9.4 |
| Signal SEQ |
Predicted
(N-terminus) |
| No. of transmembrane domain |
|
| NLS position (Columbia Univ.
Bioinformatics Center) |
none |
| NES motif (
L-x(2,3)-[IVLMF]-x(2,3)-L-x-[LI]) |
LKTLATELNL |
| Localization (YFP) |
ER with
discontinuity |
| Comments for localization |
|
| Effect of LMB on protein
localization |
no change |
| Microscope used for
observation |
DeltaVision |