| Gene name |
SPBC428.09c |
| Gene ID |
43/E01 |
| Gene synonyms/obsolete |
|
| Gene product |
removed from
GeneDB |
| Entry clone |
Cloned in 2006
trial |
| ORF length (unspliced) |
850 |
| ORF length (spliced) |
|
| Entry clone length |
850 |
| No. of intron |
1 |
| Sequence status |
Finished |
| Sequence results |
100% match |
| Comments |
Removed; almost
certainly non-coding as no branch and no MET without
splicing. |
| Polymerase used for cloning |
Pyrobest DNA Pol
(TaKaRa) |
| Fwd primer name |
SPBC428.09.Fd |
| Fwd primer SEQ |
AAAAAGCAGGCTCTCATATGGTAGTTGTCCAAAATTT |
| Rev primer name |
SPBC428.09.Rv |
| Rev primer SEQ |
AGAAAGCTGGGTACCATATAAACGGCTTTGTA |
| Amino acid length |
|
| Molecular weight |
|
| Isoelectric point (calc.) |
|
| Signal SEQ |
|
| No. of transmembrane domain |
|
| NLS position (Columbia Univ.
Bioinformatics Center) |
none |
| NES motif (
L-x(2,3)-[IVLMF]-x(2,3)-L-x-[LI]) |
LFILNGLTL |
| Localization (YFP) |
no apparent
signal |
| Comments for localization |
|
| Effect of LMB on protein
localization |
not determined |
| Microscope used for
observation |
DeltaVision |