| Gene name |
SPBC2A9.06c |
| Gene ID |
43/D08 |
| Gene synonyms/obsolete |
|
| Gene product |
conserved
hypothetical; associated with lipid particles |
| Entry clone |
Cloned |
| ORF length (unspliced) |
844 |
| ORF length (spliced) |
777 |
| Entry clone length |
844 |
| No. of intron |
1 |
| Sequence status |
Finished |
| Sequence results |
100% match |
| Comments |
|
| Polymerase used for cloning |
Pyrobest DNA Pol
(TaKaRa) |
| Fwd primer name |
SPBC2A9.06.Fd |
| Fwd primer SEQ |
AAAAAGCAGGCTCTCATATGTATGATGATATTTTCTT |
| Rev primer name |
SPBC2A9.06.Rv |
| Rev primer SEQ |
AGAAAGCTGGGTAGTGCCCTAACCGCATTTCT |
| Amino acid length |
258 |
| Molecular weight |
29.8 |
| Isoelectric point (calc.) |
6.5 |
| Signal SEQ |
Predicted
(N-terminus) |
| No. of transmembrane domain |
|
| NLS position (Columbia Univ.
Bioinformatics Center) |
none |
| NES motif (
L-x(2,3)-[IVLMF]-x(2,3)-L-x-[LI]) |
LLIIFAPLLKL |
| Localization (YFP) |
ER |
| Comments for localization |
large aggregates by
over expression |
| Effect of LMB on protein
localization |
no change |
| Microscope used for
observation |
DeltaVision |