Gene name |
SPBC21C3.17c |
Gene ID |
42/D10 |
Gene synonyms/obsolete |
|
Gene product |
hypothetical protein;
Sp specific families; possibly Sp specific; similar to Sp
SPCP31B10.04 |
Entry clone |
Cloned# |
ORF length (unspliced) |
611 |
ORF length (spliced) |
561 |
Entry clone length |
611 |
No. of intron |
1 |
Sequence status |
Finished |
Sequence results |
100% match |
Comments |
|
Polymerase used for cloning |
Pyrobest DNA Pol
(TaKaRa) |
Fwd primer name |
SPBC21C3.17.Fd |
Fwd primer SEQ |
AAAAAGCAGGCTCTCATATGAAATTCTTTCTAGGATC |
Rev primer name |
SPBC21C3.17.Rv |
Rev primer SEQ |
AGAAAGCTGGGTAATGCTTTCTATATGAAGAC |
Amino acid length |
186 |
Molecular weight |
21.2 |
Isoelectric point (calc.) |
9.9 |
Signal SEQ |
Predicted
(N-terminus) |
No. of transmembrane domain |
1 |
NLS position (Columbia Univ.
Bioinformatics Center) |
none |
NES motif (
L-x(2,3)-[IVLMF]-x(2,3)-L-x-[LI]) |
LSCCILIVLFL |
Localization (YFP) |
vacuole |
Comments for localization |
|
Effect of LMB on protein
localization |
no change |
Microscope used for
observation |
DeltaVision |