Gene name |
SPAP27G11.10c |
Gene ID |
41/A11 |
Gene synonyms/obsolete |
nup184 |
Gene product |
nuclear pore complex;
involved in mRNA export |
Entry clone |
Cloned in 2006
trial |
ORF length (unspliced) |
4766 |
ORF length (spliced) |
4695 |
Entry clone length |
4766 |
No. of intron |
1 |
Sequence status |
Partially
sequenced |
Sequence results |
100% match in both
ends |
Comments |
|
Polymerase used for cloning |
Pyrobest DNA Pol
(TaKaRa) |
Fwd primer name |
SPAP27G11.10.Fd |
Fwd primer SEQ |
AAAAAGCAGGCTCTCATATGGGTGATTATTTACTGTA |
Rev primer name |
SPAP27G11.10.Rv |
Rev primer SEQ |
AGAAAGCTGGGTAATGCTCAAGCAAAGCTCTT |
Amino acid length |
1564 |
Molecular weight |
176.9 |
Isoelectric point (calc.) |
5.5 |
Signal SEQ |
|
No. of transmembrane domain |
|
NLS position (Columbia Univ.
Bioinformatics Center) |
none |
NES motif (
L-x(2,3)-[IVLMF]-x(2,3)-L-x-[LI]) |
LIELQESLHL/LICLRGFLNL/LLCCIAPILQL/LIRGLQSLYI |
Localization (YFP) |
no apparent
signal |
Comments for localization |
|
Effect of LMB on protein
localization |
not determined |
Microscope used for
observation |
DeltaVision |