Gene name |
SPBC15D4.01c |
Gene ID |
40/G11 |
Gene synonyms/obsolete |
klp1;
SPBC2D10.21c |
Gene product |
kinesin-like
protein |
Entry clone |
Cloned |
ORF length (unspliced) |
2075 |
ORF length (spliced) |
1902 |
Entry clone length |
2075 |
No. of intron |
2 |
Sequence status |
Finished |
Sequence results |
1257G:A /
1617T:A |
Comments |
|
Polymerase used for cloning |
Platinum Taq HiFi
(Invitrogen) |
Fwd primer name |
SPBC15D4.01.Fd |
Fwd primer SEQ |
AAAAAGCAGGCTCTCATATGATACAGGTAAGCAATTT |
Rev primer name |
SPBC15D4.01.Rv |
Rev primer SEQ |
AGAAAGCTGGGTACAATTCATTAATATCGATA |
Amino acid length |
633 |
Molecular weight |
71.4 |
Isoelectric point (calc.) |
7 |
Signal SEQ |
|
No. of transmembrane domain |
|
NLS position (Columbia Univ.
Bioinformatics Center) |
none |
NES motif (
L-x(2,3)-[IVLMF]-x(2,3)-L-x-[LI]) |
none |
Localization (YFP) |
nucleus |
Comments for localization |
|
Effect of LMB on protein
localization |
no change |
Microscope used for
observation |
DeltaVision |