| Gene name |
SPBC725.16 |
| Gene ID |
40/G10 |
| Gene synonyms/obsolete |
sct1; res1 |
| Gene product |
DSC1/MBF trancription
factor complex; partner of Cdc10p transcription factor;
ankyrin repeat protein; APSES domain; DNA-binding protein;
regulator of mitotic cell cycle (positive); Mlu1-box binding
factor (MBF); involved in transcriptional activation; involved
in control of start (required); involved in control of
mitosis; similar to Sp SPBC336.12c and SPAC22F3.09c |
| Entry clone |
Cloned |
| ORF length (unspliced) |
2041 |
| ORF length (spliced) |
1914 |
| Entry clone length |
2041 |
| No. of intron |
1 |
| Sequence status |
Finished |
| Sequence results |
1983T:C |
| Comments |
|
| Polymerase used for cloning |
Platinum Taq HiFi
(Invitrogen) |
| Fwd primer name |
SPBC725.16.Fd |
| Fwd primer SEQ |
AAAAAGCAGGCTCTCATATGTATAACGACCAAATACA |
| Rev primer name |
SPBC725.16.Rv |
| Rev primer SEQ |
AGAAAGCTGGGTAAGATCCACTTTGATCTGTA |
| Amino acid length |
637 |
| Molecular weight |
72.4 |
| Isoelectric point (calc.) |
6.1 |
| Signal SEQ |
|
| No. of transmembrane domain |
|
| NLS position (Columbia Univ.
Bioinformatics Center) |
none |
| NES motif (
L-x(2,3)-[IVLMF]-x(2,3)-L-x-[LI]) |
none |
| Localization (YFP) |
nuclear dots;
nucleus |
| Comments for localization |
|
| Effect of LMB on protein
localization |
no change |
| Microscope used for
observation |
DeltaVision |