Gene name |
SPBC3H7.15 |
Gene ID |
40/D07 |
Gene synonyms/obsolete |
hhp1 |
Gene product |
serine/threonine
protein kinase; casein kinase I; involved in DNA repair
(regulation) (required) |
Entry clone |
Cloned |
ORF length (unspliced) |
1220 |
ORF length (spliced) |
1098 |
Entry clone length |
1220 |
No. of intron |
1 |
Sequence status |
Finished |
Sequence results |
406T:C |
Comments |
|
Polymerase used for cloning |
Platinum Taq HiFi
(Invitrogen) |
Fwd primer name |
SPBC3H7.15.Fd |
Fwd primer SEQ |
AAAAAGCAGGCTCTCATATGGCTTTGGACCTCCGGAT |
Rev primer name |
SPBC3H7.15.Rv |
Rev primer SEQ |
AGAAAGCTGGGTAATTAGGTCTGTTGATATAT |
Amino acid length |
365 |
Molecular weight |
42.4 |
Isoelectric point (calc.) |
9.6 |
Signal SEQ |
|
No. of transmembrane domain |
|
NLS position (Columbia Univ.
Bioinformatics Center) |
none |
NES motif (
L-x(2,3)-[IVLMF]-x(2,3)-L-x-[LI]) |
none |
Localization (YFP) |
cytosol=nucleus;
periphery at site of septum formation |
Comments for localization |
cytoplasmic dots and
nuclear dots by over expression |
Effect of LMB on protein
localization |
no change |
Microscope used for
observation |
DeltaVision |