| Gene name |
SPAC17A2.09c |
| Gene ID |
39/F02 |
| Gene synonyms/obsolete |
csx1 |
| Gene product |
RNA-binding
post-transcriptional regulator RNA-binding protein; involved
in post-transcriptional regulation; rrm RNA recognition motif;
no apparent Sc ortholog |
| Entry clone |
Cloned |
| ORF length (unspliced) |
1899 |
| ORF length (spliced) |
|
| Entry clone length |
1899 |
| No. of intron |
0 |
| Sequence status |
Finished |
| Sequence results |
753T:C / 1159G:A |
| Comments |
|
| Polymerase used for cloning |
Platinum Taq HiFi
(Invitrogen) |
| Fwd primer name |
SPAC17A2.09.Fd |
| Fwd primer SEQ |
AAAAAGCAGGCTCTCATATGTCTATTGACTGCCTTTA |
| Rev primer name |
SPAC17A2.09.Rv |
| Rev primer SEQ |
AGAAAGCTGGGTATGAATCGCGTGACAAGCGT |
| Amino acid length |
632 |
| Molecular weight |
67.8 |
| Isoelectric point (calc.) |
8.4 |
| Signal SEQ |
|
| No. of transmembrane domain |
|
| NLS position (Columbia Univ.
Bioinformatics Center) |
none |
| NES motif (
L-x(2,3)-[IVLMF]-x(2,3)-L-x-[LI]) |
LLTRVSSLKL |
| Localization (YFP) |
cytosol |
| Comments for localization |
cytoplasmic dots by
over expression |
| Effect of LMB on protein
localization |
no change |
| Microscope used for
observation |
DeltaVision |