| Gene name |
SPAPJ698.01c |
| Gene ID |
39/E11 |
| Gene synonyms/obsolete |
rfc3;
SPAC27E2.10c |
| Gene product |
replication factor C
36 kD subunit; activator AAA family ATPase; replication factor
C (activator 1) subunit; activator of DNA polymerases;
involved in DNA damage checkpoint |
| Entry clone |
Cloned |
| ORF length (unspliced) |
1496 |
| ORF length (spliced) |
1029 |
| Entry clone length |
1496 |
| No. of intron |
5 |
| Sequence status |
Finished |
| Sequence results |
452A:G / 1306A:G |
| Comments |
|
| Polymerase used for cloning |
Platinum Taq HiFi
(Invitrogen) |
| Fwd primer name |
SPAPJ698.01.Fd |
| Fwd primer SEQ |
AAAAAGCAGGCTCTCATATGTCTATCGAAAAAGGTAA |
| Rev primer name |
SPAPJ698.01.Rv |
| Rev primer SEQ |
AGAAAGCTGGGTAATTTACCTTTGCTGCTAAA |
| Amino acid length |
342 |
| Molecular weight |
38.4 |
| Isoelectric point (calc.) |
7.9 |
| Signal SEQ |
|
| No. of transmembrane domain |
|
| NLS position (Columbia Univ.
Bioinformatics Center) |
none |
| NES motif (
L-x(2,3)-[IVLMF]-x(2,3)-L-x-[LI]) |
none |
| Localization (YFP) |
nucleus>cytosol |
| Comments for localization |
|
| Effect of LMB on protein
localization |
no change |
| Microscope used for
observation |
Leica |