Gene name |
SPAC6F12.09 |
Gene ID |
39/B11 |
Gene synonyms/obsolete |
|
Gene product |
putative RNA-directed
rna polymerase RNA-directed RNA polymerase; involved in RNA
interference; involved in PTGS; involved in the regulation of
chromatin silencing at the centromere; involved in the
regulation of histone L9 methylation; no apparent Sc
ortholog |
Entry clone |
Cloned |
ORF length (unspliced) |
3648 |
ORF length (spliced) |
|
Entry clone length |
3648 |
No. of intron |
0 |
Sequence status |
Finished |
Sequence results |
387A:G / 1638T:C /
2360A:G / 2598T:C / 3362A:G |
Comments |
|
Polymerase used for cloning |
Platinum Taq HiFi
(Invitrogen) |
Fwd primer name |
SPAC6F12.09.Fd |
Fwd primer SEQ |
AAAAAGCAGGCTCTCATATGGCAGTTTCGTTAAATGA |
Rev primer name |
SPAC6F12.09.Rv |
Rev primer SEQ |
AGAAAGCTGGGTAAAAATTATTAGCAGTAAGC |
Amino acid length |
1215 |
Molecular weight |
139.4 |
Isoelectric point (calc.) |
8.7 |
Signal SEQ |
|
No. of transmembrane domain |
|
NLS position (Columbia Univ.
Bioinformatics Center) |
none |
NES motif (
L-x(2,3)-[IVLMF]-x(2,3)-L-x-[LI]) |
LGDMITLVI/LSVIRRLSL/LKTRVIVGLCI |
Localization (YFP) |
nucleus>cytosol |
Comments for localization |
|
Effect of LMB on protein
localization |
no change |
Microscope used for
observation |
Leica |