| Gene name |
SPCC306.04c |
| Gene ID |
39/B01 |
| Gene synonyms/obsolete |
|
| Gene product |
SET domain protein;
transcriptional silencing SET1 complex (TAP); SET domain;
histone lysine methyltransferase (H3-K4); involved in
transcriptional silencing; involved in regulation of chromatin
remodeling; involved in telomere maintenance; involved in DNA
repair; deletion mutant results in telomere lengthening;
non-essential; RNA-binding protein; ATM kinase Rad3-dependent
pathway; rrm RNA recognition motif |
| Entry clone |
Cloned |
| ORF length (unspliced) |
2763 |
| ORF length (spliced) |
|
| Entry clone length |
2763 |
| No. of intron |
0 |
| Sequence status |
Finished |
| Sequence results |
100% match |
| Comments |
|
| Polymerase used for cloning |
Platinum Taq HiFi
(Invitrogen) |
| Fwd primer name |
SPCC306.04.Fd |
| Fwd primer SEQ |
AAAAAGCAGGCTCTCATATGGATTTTAATACCTCTAC |
| Rev primer name |
SPCC306.04.Rv |
| Rev primer SEQ |
AGAAAGCTGGGTAGTTTAAATAGCCACGACAT |
| Amino acid length |
920 |
| Molecular weight |
105 |
| Isoelectric point (calc.) |
9.2 |
| Signal SEQ |
|
| No. of transmembrane domain |
|
| NLS position (Columbia Univ.
Bioinformatics Center) |
468/467 |
| NES motif (
L-x(2,3)-[IVLMF]-x(2,3)-L-x-[LI]) |
none |
| Localization (YFP) |
cytoplasmic dots |
| Comments for localization |
|
| Effect of LMB on protein
localization |
no change |
| Microscope used for
observation |
Leica |