| Gene name |
SPAC17A2.12 |
| Gene ID |
38/H11 |
| Gene synonyms/obsolete |
|
| Gene product |
zinc finger protein;
zf-C3HC4 type (RING finger); ubiquitin ligase; SNF2 family;
helicase C-terminal domain; DEAD/DEAH box helicase; similar to
Sp SPBC23E6.02 (paralog); involved in DNA repair |
| Entry clone |
Cloned |
| ORF length (unspliced) |
2694 |
| ORF length (spliced) |
|
| Entry clone length |
2694 |
| No. of intron |
0 |
| Sequence status |
Finished |
| Sequence results |
1351T:C |
| Comments |
|
| Polymerase used for cloning |
Platinum Taq HiFi
(Invitrogen) |
| Fwd primer name |
SPAC17A2.12.Fd |
| Fwd primer SEQ |
AAAAAGCAGGCTCTCATATGGATTCATTGTCTGCATA |
| Rev primer name |
SPAC17A2.12.Rv |
| Rev primer SEQ |
AGAAAGCTGGGTATGAATTAAGCCCAAATAGA |
| Amino acid length |
897 |
| Molecular weight |
101.3 |
| Isoelectric point (calc.) |
8.6 |
| Signal SEQ |
|
| No. of transmembrane domain |
|
| NLS position (Columbia Univ.
Bioinformatics Center) |
none |
| NES motif (
L-x(2,3)-[IVLMF]-x(2,3)-L-x-[LI]) |
LNSLKQLEL/LCLVSHMLKL |
| Localization (YFP) |
nucleus>cytosol |
| Comments for localization |
|
| Effect of LMB on protein
localization |
no change |
| Microscope used for
observation |
Leica |