| Gene name |
SPAC637.04 |
| Gene ID |
38/H10 |
| Gene synonyms/obsolete |
|
| Gene product |
hypothetical protein;
ScYGR198W is null lethal; TPR repeat protein |
| Entry clone |
Cloned in 2004
trial |
| ORF length (unspliced) |
2684 |
| ORF length (spliced) |
2589 |
| Entry clone length |
2684 |
| No. of intron |
2 |
| Sequence status |
Finished |
| Sequence results |
100% match |
| Comments |
|
| Polymerase used for cloning |
Pyrobest DNA Pol
(TaKaRa) |
| Fwd primer name |
SPAC637.04.Fd |
| Fwd primer SEQ |
AAAAAGCAGGCTCTCATATGTTTTCCGTACGTCTAAA |
| Rev primer name |
SPAC637.04.Rv |
| Rev primer SEQ |
AGAAAGCTGGGTAAACGTTCATAAACCTAGGC |
| Amino acid length |
862 |
| Molecular weight |
98.3 |
| Isoelectric point (calc.) |
7.1 |
| Signal SEQ |
|
| No. of transmembrane domain |
|
| NLS position (Columbia Univ.
Bioinformatics Center) |
none |
| NES motif (
L-x(2,3)-[IVLMF]-x(2,3)-L-x-[LI]) |
LLSQLNSLNI/LVDLLITKLAL |
| Localization (YFP) |
periphery at cell tip
and site of septum formation; cytosol |
| Comments for localization |
a few cytoplasmic dots
by over expression |
| Effect of LMB on protein
localization |
changed to:
nucleus>cytosol; periphery |
| Microscope used for
observation |
DeltaVision |