| Gene name |
SPBC902.01c |
| Gene ID |
38/G01 |
| Gene synonyms/obsolete |
alp6;
SPBC428.20c |
| Gene product |
gamma-tubulin complex;
spindle pole body component; involved in spindle assembly
checkpoint; essential |
| Entry clone |
Cloned# |
| ORF length (unspliced) |
2631 |
| ORF length (spliced) |
2466 |
| Entry clone length |
2631 |
| No. of intron |
3 |
| Sequence status |
Finished |
| Sequence results |
100% match |
| Comments |
|
| Polymerase used for cloning |
Pyrobest DNA Pol
(TaKaRa) |
| Fwd primer name |
SPBC902.01.Fd |
| Fwd primer SEQ |
AAAAAGCAGGCTCTCATATGTCGGAGATTCATGTGAA |
| Rev primer name |
SPBC902.01.Rv |
| Rev primer SEQ |
AGAAAGCTGGGTATTGACTGGTAACATCCTTA |
| Amino acid length |
821 |
| Molecular weight |
94.5 |
| Isoelectric point (calc.) |
6 |
| Signal SEQ |
|
| No. of transmembrane domain |
|
| NLS position (Columbia Univ.
Bioinformatics Center) |
none |
| NES motif (
L-x(2,3)-[IVLMF]-x(2,3)-L-x-[LI]) |
LKAIKKYLLL |
| Localization (YFP) |
SPB;
nucleus>=cytosol; periphery at site of septum
formation |
| Comments for localization |
cytoplasmic dots by
over expression? |
| Effect of LMB on protein
localization |
no change |
| Microscope used for
observation |
DeltaVision |