| Gene name |
SPAC3A11.06 |
| Gene ID |
38/F12 |
| Gene synonyms/obsolete |
mvp1 |
| Gene product |
phosphoinositide
binding; PX domain; involved in intracellular protein
transport |
| Entry clone |
Cloned; Mixture |
| ORF length (unspliced) |
2627 |
| ORF length (spliced) |
1955 |
| Entry clone length |
2627 |
| No. of intron |
9 |
| Sequence status |
Finished |
| Sequence results |
Mixture |
| Comments |
Mixture of 2 clones,
one of which is frameshifted from 205. |
| Polymerase used for cloning |
Platinum Taq HiFi
(Invitrogen) |
| Fwd primer name |
SPAC3A11.06.Fd |
| Fwd primer SEQ |
AAAAAGCAGGCTCTCATATGGGCGATAATGTATTTTT |
| Rev primer name |
SPAC3A11.06.Rv |
| Rev primer SEQ |
AGAAAGCTGGGTAAGTTTCAAGCCGAGAAAAA |
| Amino acid length |
664 |
| Molecular weight |
76.8 |
| Isoelectric point (calc.) |
7 |
| Signal SEQ |
|
| No. of transmembrane domain |
|
| NLS position (Columbia Univ.
Bioinformatics Center) |
none |
| NES motif (
L-x(2,3)-[IVLMF]-x(2,3)-L-x-[LI]) |
none |
| Localization (YFP) |
Golgi; vacuole
membrane |
| Comments for localization |
|
| Effect of LMB on protein
localization |
no change |
| Microscope used for
observation |
DeltaVision |