| Gene name |
SPAC1B1.03c |
| Gene ID |
38/E07 |
| Gene synonyms/obsolete |
|
| Gene product |
karyopherin-beta;
targets proteins with nuclear localization (NLS) sequences to
the nuclear pore complex; armadillo repeat protein; HEAT
repeat |
| Entry clone |
Cloned |
| ORF length (unspliced) |
2592 |
| ORF length (spliced) |
|
| Entry clone length |
2592 |
| No. of intron |
0 |
| Sequence status |
Finished |
| Sequence results |
2023A:C/ 1933T:C |
| Comments |
|
| Polymerase used for cloning |
Pyrobest DNA Pol
(TaKaRa) |
| Fwd primer name |
SPAC1B1.03.Fd |
| Fwd primer SEQ |
AAAAAGCAGGCTCTCATATGAACGCAGGTGAGTTTTT |
| Rev primer name |
SPAC1B1.03.Rv |
| Rev primer SEQ |
AGAAAGCTGGGTAAGCTCTAGCTTGACGCTTA |
| Amino acid length |
863 |
| Molecular weight |
94.7 |
| Isoelectric point (calc.) |
4.2 |
| Signal SEQ |
|
| No. of transmembrane domain |
|
| NLS position (Columbia Univ.
Bioinformatics Center) |
none |
| NES motif (
L-x(2,3)-[IVLMF]-x(2,3)-L-x-[LI]) |
LPMIANVLSI |
| Localization (YFP) |
nuclear envelope |
| Comments for localization |
|
| Effect of LMB on protein
localization |
no change |
| Microscope used for
observation |
DeltaVision |