| Gene name |
SPCC1322.03 |
| Gene ID |
38/E06 |
| Gene synonyms/obsolete |
|
| Gene product |
hypothetical
protein |
| Entry clone |
Cloned |
| ORF length (unspliced) |
2589 |
| ORF length (spliced) |
|
| Entry clone length |
2589 |
| No. of intron |
0 |
| Sequence status |
Finished |
| Sequence results |
968G:A / 1725A:G /
2047A:G |
| Comments |
|
| Polymerase used for cloning |
Platinum Taq HiFi
(Invitrogen) |
| Fwd primer name |
SPCC1322.03.Fd |
| Fwd primer SEQ |
AAAAAGCAGGCTCTCATATGAAGCCTCGCCCGTACTC |
| Rev primer name |
SPCC1322.03.Rv |
| Rev primer SEQ |
AGAAAGCTGGGTATGGATGTGGAATCGACCAG |
| Amino acid length |
862 |
| Molecular weight |
97.4 |
| Isoelectric point (calc.) |
8.7 |
| Signal SEQ |
Predicted
(N-terminus) |
| No. of transmembrane domain |
11 |
| NLS position (Columbia Univ.
Bioinformatics Center) |
none |
| NES motif (
L-x(2,3)-[IVLMF]-x(2,3)-L-x-[LI]) |
LDPRLKVLGI/LQKPLPQLHI |
| Localization (YFP) |
Golgi; cytoplasmic
dots |
| Comments for localization |
|
| Effect of LMB on protein
localization |
no change |
| Microscope used for
observation |
DeltaVision |