Gene name |
SPAC19D5.01 |
Gene ID |
37/E03 |
Gene synonyms/obsolete |
pyp2 |
Gene product |
protein-tyrosine
phosphatase; functionally overlapping with;
nuclear/cytoplasmic; rhodanase-like domain; negative regulator
of meiosis; dephosphorylate an osmosensing MAP kinase
controlling cell size at division; inactivates Sty1p kinase in
response to stress; similar to Sp pyp1 |
Entry clone |
Cloned |
ORF length (unspliced) |
2136 |
ORF length (spliced) |
|
Entry clone length |
2136 |
No. of intron |
0 |
Sequence status |
Finished |
Sequence results |
100% match |
Comments |
|
Polymerase used for cloning |
Platinum Taq HiFi
(Invitrogen) |
Fwd primer name |
SPAC19D5.01.Fd |
Fwd primer SEQ |
AAAAAGCAGGCTCTCATATGCTCCATCTTCTGTCTAA |
Rev primer name |
SPAC19D5.01.Rv |
Rev primer SEQ |
AGAAAGCTGGGTAAGTCATCAAGGGCTTGGAA |
Amino acid length |
711 |
Molecular weight |
79.3 |
Isoelectric point (calc.) |
8.8 |
Signal SEQ |
|
No. of transmembrane domain |
|
NLS position (Columbia Univ.
Bioinformatics Center) |
none |
NES motif (
L-x(2,3)-[IVLMF]-x(2,3)-L-x-[LI]) |
none |
Localization (YFP) |
nucleus>cytosol;
mitochondrion |
Comments for localization |
|
Effect of LMB on protein
localization |
no change |
Microscope used for
observation |
Confocal;
DeltaVision |