| Gene name |
SPBP23A10.04 |
| Gene ID |
37/E02 |
| Gene synonyms/obsolete |
|
| Gene product |
anaphase-promoting
complex (APC); required for cyclin degradation; involved in
metaphase-anaphase transition; cullin family |
| Entry clone |
Cloned |
| ORF length (unspliced) |
2135 |
| ORF length (spliced) |
2091 |
| Entry clone length |
2135 |
| No. of intron |
1 |
| Sequence status |
Finished |
| Sequence results |
78A:G / 1204T:C |
| Comments |
|
| Polymerase used for cloning |
Platinum Taq HiFi
(Invitrogen) |
| Fwd primer name |
SPBP23A10.04.Fd |
| Fwd primer SEQ |
AAAAAGCAGGCTCTCATATGAATGATACTGATCTGTC |
| Rev primer name |
SPBP23A10.04.Rv |
| Rev primer SEQ |
AGAAAGCTGGGTATTTGAGCTTATAAGCTCCT |
| Amino acid length |
696 |
| Molecular weight |
80.5 |
| Isoelectric point (calc.) |
5.2 |
| Signal SEQ |
|
| No. of transmembrane domain |
|
| NLS position (Columbia Univ.
Bioinformatics Center) |
none |
| NES motif (
L-x(2,3)-[IVLMF]-x(2,3)-L-x-[LI]) |
LDFIDKLRI/LCEKFKQLGL/LKERFVYVLQL/LGAIEDLRL/LTNLGALEL/LREFLALMI |
| Localization (YFP) |
nucleus>=cytosol |
| Comments for localization |
cytoplasmic dots by
over expression |
| Effect of LMB on protein
localization |
changed to:
nucleus>cytosol |
| Microscope used for
observation |
Leica |