Gene name |
SPBP23A10.04 |
Gene ID |
37/E02 |
Gene synonyms/obsolete |
|
Gene product |
anaphase-promoting
complex (APC); required for cyclin degradation; involved in
metaphase-anaphase transition; cullin family |
Entry clone |
Cloned |
ORF length (unspliced) |
2135 |
ORF length (spliced) |
2091 |
Entry clone length |
2135 |
No. of intron |
1 |
Sequence status |
Finished |
Sequence results |
78A:G / 1204T:C |
Comments |
|
Polymerase used for cloning |
Platinum Taq HiFi
(Invitrogen) |
Fwd primer name |
SPBP23A10.04.Fd |
Fwd primer SEQ |
AAAAAGCAGGCTCTCATATGAATGATACTGATCTGTC |
Rev primer name |
SPBP23A10.04.Rv |
Rev primer SEQ |
AGAAAGCTGGGTATTTGAGCTTATAAGCTCCT |
Amino acid length |
696 |
Molecular weight |
80.5 |
Isoelectric point (calc.) |
5.2 |
Signal SEQ |
|
No. of transmembrane domain |
|
NLS position (Columbia Univ.
Bioinformatics Center) |
none |
NES motif (
L-x(2,3)-[IVLMF]-x(2,3)-L-x-[LI]) |
LDFIDKLRI/LCEKFKQLGL/LKERFVYVLQL/LGAIEDLRL/LTNLGALEL/LREFLALMI |
Localization (YFP) |
nucleus>=cytosol |
Comments for localization |
cytoplasmic dots by
over expression |
Effect of LMB on protein
localization |
changed to:
nucleus>cytosol |
Microscope used for
observation |
Leica |