Gene name |
SPAC222.07c |
Gene ID |
37/D05 |
Gene synonyms/obsolete |
hri2 |
Gene product |
serine/threonine
protein kinase; eIF2 kinase; possibly regulates initiation of
translation by phosphorylation of eIF2alpha; similar to Sp
hri1 (paralog); no apparent Sc ortholog |
Entry clone |
Cloned |
ORF length (unspliced) |
2120 |
ORF length (spliced) |
1920 |
Entry clone length |
2120 |
No. of intron |
3 |
Sequence status |
Finished |
Sequence results |
114T:A / 291A:G |
Comments |
|
Polymerase used for cloning |
Platinum Taq HiFi
(Invitrogen) |
Fwd primer name |
SPAC222.07.Fd |
Fwd primer SEQ |
AAAAAGCAGGCTCTCATATGCGATTTTTCAACGCTCA |
Rev primer name |
SPAC222.07.Rv |
Rev primer SEQ |
AGAAAGCTGGGTAGCGGGTTTCAAGATGTTGA |
Amino acid length |
639 |
Molecular weight |
73.3 |
Isoelectric point (calc.) |
5.8 |
Signal SEQ |
|
No. of transmembrane domain |
|
NLS position (Columbia Univ.
Bioinformatics Center) |
none |
NES motif (
L-x(2,3)-[IVLMF]-x(2,3)-L-x-[LI]) |
LLEVLNCGLLL |
Localization (YFP) |
cytosol |
Comments for localization |
|
Effect of LMB on protein
localization |
changed to:
cytosol=nucleus |
Microscope used for
observation |
Leica |