| Gene name |
SPAC222.07c |
| Gene ID |
37/D05 |
| Gene synonyms/obsolete |
hri2 |
| Gene product |
serine/threonine
protein kinase; eIF2 kinase; possibly regulates initiation of
translation by phosphorylation of eIF2alpha; similar to Sp
hri1 (paralog); no apparent Sc ortholog |
| Entry clone |
Cloned |
| ORF length (unspliced) |
2120 |
| ORF length (spliced) |
1920 |
| Entry clone length |
2120 |
| No. of intron |
3 |
| Sequence status |
Finished |
| Sequence results |
114T:A / 291A:G |
| Comments |
|
| Polymerase used for cloning |
Platinum Taq HiFi
(Invitrogen) |
| Fwd primer name |
SPAC222.07.Fd |
| Fwd primer SEQ |
AAAAAGCAGGCTCTCATATGCGATTTTTCAACGCTCA |
| Rev primer name |
SPAC222.07.Rv |
| Rev primer SEQ |
AGAAAGCTGGGTAGCGGGTTTCAAGATGTTGA |
| Amino acid length |
639 |
| Molecular weight |
73.3 |
| Isoelectric point (calc.) |
5.8 |
| Signal SEQ |
|
| No. of transmembrane domain |
|
| NLS position (Columbia Univ.
Bioinformatics Center) |
none |
| NES motif (
L-x(2,3)-[IVLMF]-x(2,3)-L-x-[LI]) |
LLEVLNCGLLL |
| Localization (YFP) |
cytosol |
| Comments for localization |
|
| Effect of LMB on protein
localization |
changed to:
cytosol=nucleus |
| Microscope used for
observation |
Leica |