| Gene name |
SPAP14E8.06c |
| Gene ID |
37/D04 |
| Gene synonyms/obsolete |
orp3; orc3;
SPAC3H1.01c |
| Gene product |
origin recognition
complex (subunit 3) |
| Entry clone |
Cloned# |
| ORF length (unspliced) |
2117 |
| ORF length (spliced) |
2073 |
| Entry clone length |
2117 |
| No. of intron |
1 |
| Sequence status |
Finished |
| Sequence results |
100% match |
| Comments |
|
| Polymerase used for cloning |
Pyrobest DNA Pol
(TaKaRa) |
| Fwd primer name |
SPAP14E8.06.Fd |
| Fwd primer SEQ |
AAAAAGCAGGCTCTCATATGTCAGCAATACTACAATA |
| Rev primer name |
SPAP14E8.06.Rv |
| Rev primer SEQ |
AGAAAGCTGGGTACTGATGATAAATAGTTTTC |
| Amino acid length |
690 |
| Molecular weight |
80.1 |
| Isoelectric point (calc.) |
5.6 |
| Signal SEQ |
|
| No. of transmembrane domain |
|
| NLS position (Columbia Univ.
Bioinformatics Center) |
none |
| NES motif (
L-x(2,3)-[IVLMF]-x(2,3)-L-x-[LI]) |
LYTIFNLKI/LFTSIEESLSL/LISWLPDLSI/LEELRFLGL |
| Localization (YFP) |
no apparent
signal |
| Comments for localization |
|
| Effect of LMB on protein
localization |
not determined |
| Microscope used for
observation |
DeltaVision |