Gene name |
SPCC1919.15 |
Gene ID |
37/C09 |
Gene synonyms/obsolete |
SPCC790.01 |
Gene product |
zinc finger protein;
zf-C3HC4 type (RING finger); ubiquitin ligase (E3); involved
in ubiquitination; involved in histone H2B monoubiquitination;
similar to Sp SPCC970.10C |
Entry clone |
Cloned |
ORF length (unspliced) |
2079 |
ORF length (spliced) |
|
Entry clone length |
2079 |
No. of intron |
0 |
Sequence status |
Finished |
Sequence results |
204T:C / 1100T:C |
Comments |
|
Polymerase used for cloning |
Platinum Taq HiFi
(Invitrogen) |
Fwd primer name |
SPCC1919.15.Fd |
Fwd primer SEQ |
AAAAAGCAGGCTCTCATATGAGCGTTGTGAATGAATC |
Rev primer name |
SPCC1919.15.Rv |
Rev primer SEQ |
AGAAAGCTGGGTAAAGATGAATGGTCAAAATG |
Amino acid length |
692 |
Molecular weight |
80.7 |
Isoelectric point (calc.) |
6.4 |
Signal SEQ |
|
No. of transmembrane domain |
|
NLS position (Columbia Univ.
Bioinformatics Center) |
7/8 |
NES motif (
L-x(2,3)-[IVLMF]-x(2,3)-L-x-[LI]) |
none |
Localization (YFP) |
nucleus |
Comments for localization |
|
Effect of LMB on protein
localization |
no change |
Microscope used for
observation |
Leica |