Gene name |
SPBC800.03 |
Gene ID |
37/C08 |
Gene synonyms/obsolete |
clr3 |
Gene product |
histone deacetylase;
NAD-independent histone deacetylase activity; histone
deacetylase (H3 K14 specific); HDA1-like (class II); cryptic
loci regulator; involved in chromatin silencing; involved in
chromatin silencing of rDNA (required); involved in chromatin
silencing at silent mating type cassettes (sensu Fungi)
(required) |
Entry clone |
Cloned |
ORF length (unspliced) |
2064 |
ORF length (spliced) |
|
Entry clone length |
2064 |
No. of intron |
0 |
Sequence status |
Finished |
Sequence results |
1444A:G |
Comments |
|
Polymerase used for cloning |
Platinum Taq HiFi
(Invitrogen) |
Fwd primer name |
SPBC800.03.Fd |
Fwd primer SEQ |
AAAAAGCAGGCTCTCATATGCTGGCCTCTAATTCTGA |
Rev primer name |
SPBC800.03.Rv |
Rev primer SEQ |
AGAAAGCTGGGTACTGAGAAGTTGGTCGGGCC |
Amino acid length |
687 |
Molecular weight |
76.7 |
Isoelectric point (calc.) |
6.3 |
Signal SEQ |
|
No. of transmembrane domain |
|
NLS position (Columbia Univ.
Bioinformatics Center) |
none |
NES motif (
L-x(2,3)-[IVLMF]-x(2,3)-L-x-[LI]) |
LSEVKELCL |
Localization (YFP) |
nucleus |
Comments for localization |
|
Effect of LMB on protein
localization |
no change |
Microscope used for
observation |
Leica |