Gene name |
SPAC23D3.14c |
Gene ID |
37/A12 |
Gene synonyms/obsolete |
|
Gene product |
alpha-amylase; GPI
anchored protein; glycoprotein; no apparent Sc ortholog |
Entry clone |
Cloned |
ORF length (unspliced) |
1949 |
ORF length (spliced) |
1746 |
Entry clone length |
1949 |
No. of intron |
3 |
Sequence status |
Finished |
Sequence results |
644C:deletion |
Comments |
|
Polymerase used for cloning |
Platinum Taq HiFi
(Invitrogen) |
Fwd primer name |
SPAC23D3.14.Fd |
Fwd primer SEQ |
AAAAAGCAGGCTCTCATATGAATTACCGTAGAAATAT |
Rev primer name |
SPAC23D3.14.Rv |
Rev primer SEQ |
AGAAAGCTGGGTAAATGAGAATAATCATGGGT |
Amino acid length |
581 |
Molecular weight |
67 |
Isoelectric point (calc.) |
4.8 |
Signal SEQ |
Predicted
(N-terminus) |
No. of transmembrane domain |
1 |
NLS position (Columbia Univ.
Bioinformatics Center) |
none |
NES motif (
L-x(2,3)-[IVLMF]-x(2,3)-L-x-[LI]) |
none |
Localization (YFP) |
ER |
Comments for localization |
|
Effect of LMB on protein
localization |
no change |
Microscope used for
observation |
Leica |