Gene name |
SPAC1786.02 |
Gene ID |
37/A11 |
Gene synonyms/obsolete |
|
Gene product |
lysophospholipase;
similar to Sp SPAC977.09c and SPAC1A6.03c and SPCC1450.09c and
SPBC1348.10c and SPAC1A6.04c; GPI anchored protein (pers.
comm. Birgit Eisenhaber); glycoprotein |
Entry clone |
Cloned |
ORF length (unspliced) |
1935 |
ORF length (spliced) |
|
Entry clone length |
1935 |
No. of intron |
0 |
Sequence status |
Finished |
Sequence results |
411T:C |
Comments |
|
Polymerase used for cloning |
Platinum Taq HiFi
(Invitrogen) |
Fwd primer name |
SPAC1786.02.Fd |
Fwd primer SEQ |
AAAAAGCAGGCTCTCATATGTATTTTCAGTCTTTCTA |
Rev primer name |
SPAC1786.02.Rv |
Rev primer SEQ |
AGAAAGCTGGGTAAGCAGTAACTAGCAAAGTA |
Amino acid length |
644 |
Molecular weight |
70.5 |
Isoelectric point (calc.) |
4.7 |
Signal SEQ |
Predicted
(N-terminus) |
No. of transmembrane domain |
|
NLS position (Columbia Univ.
Bioinformatics Center) |
none |
NES motif (
L-x(2,3)-[IVLMF]-x(2,3)-L-x-[LI]) |
none |
Localization (YFP) |
ER |
Comments for localization |
|
Effect of LMB on protein
localization |
no change |
Microscope used for
observation |
Leica |