Gene name |
SPBC577.12 |
Gene ID |
37/A06 |
Gene synonyms/obsolete |
|
Gene product |
endoribonuclease;
DUF71 |
Entry clone |
Cloned |
ORF length (unspliced) |
1916 |
ORF length (spliced) |
1821 |
Entry clone length |
1916 |
No. of intron |
1 |
Sequence status |
Finished |
Sequence results |
1319T:C /
1798T:C |
Comments |
|
Polymerase used for cloning |
Platinum Taq HiFi
(Invitrogen) |
Fwd primer name |
SPBC577.12.Fd |
Fwd primer SEQ |
AAAAAGCAGGCTCTCATATGAAGGTCTTAGGGCTAAT |
Rev primer name |
SPBC577.12.Rv |
Rev primer SEQ |
AGAAAGCTGGGTATACATTTTGATCTCTAGCT |
Amino acid length |
606 |
Molecular weight |
67.6 |
Isoelectric point (calc.) |
5.6 |
Signal SEQ |
|
No. of transmembrane domain |
|
NLS position (Columbia Univ.
Bioinformatics Center) |
none |
NES motif (
L-x(2,3)-[IVLMF]-x(2,3)-L-x-[LI]) |
LIPSVMELKL |
Localization (YFP) |
cytosol=nucleus |
Comments for localization |
|
Effect of LMB on protein
localization |
no change |
Microscope used for
observation |
Leica |