| Gene name |
SPBC1703.15c |
| Gene ID |
37/A05 |
| Gene synonyms/obsolete |
vps33;
SPBC2A9.01c |
| Gene product |
sec1 family; involved
in vacuolar biogenesis (required); SNARE binding activity;
SNARE docking complex (TRAPP?); involved in non-selective
vesicle docking; syntaxin binding protein; involved in
intracellular protein transport; involved in secretory
pathway; involved in exocytosis; involved in non-selective
vesicle docking; involved in ER to Golgi transport; involved
in vacuole fusion |
| Entry clone |
Cloned# |
| ORF length (unspliced) |
1915 |
| ORF length (spliced) |
1779 |
| Entry clone length |
1915 |
| No. of intron |
3 |
| Sequence status |
Finished |
| Sequence results |
100% match |
| Comments |
|
| Polymerase used for cloning |
Pyrobest DNA Pol
(TaKaRa) |
| Fwd primer name |
SPBC1703.15.Fd |
| Fwd primer SEQ |
AAAAAGCAGGCTCTCATATGACTACAGACGTTAAAGA |
| Rev primer name |
SPBC1703.15.Rv |
| Rev primer SEQ |
AGAAAGCTGGGTACTCATTCAAAGATTCAATA |
| Amino acid length |
592 |
| Molecular weight |
67.6 |
| Isoelectric point (calc.) |
5.8 |
| Signal SEQ |
|
| No. of transmembrane domain |
|
| NLS position (Columbia Univ.
Bioinformatics Center) |
none |
| NES motif (
L-x(2,3)-[IVLMF]-x(2,3)-L-x-[LI]) |
LDKDLLSLEL |
| Localization (YFP) |
nucleus>=cytosol |
| Comments for localization |
|
| Effect of LMB on protein
localization |
no change |
| Microscope used for
observation |
DeltaVision |