Gene name |
SPBP8B7.14c |
Gene ID |
36/H09 |
Gene synonyms/obsolete |
dpb2 |
Gene product |
DNA polymerase epsilon
(subunit b); essential; involved in DNA replication
(initiation); assembly of the replicative complex; origin
binding |
Entry clone |
Cloned |
ORF length (unspliced) |
1867 |
ORF length (spliced) |
1785 |
Entry clone length |
1867 |
No. of intron |
2 |
Sequence status |
Finished |
Sequence results |
1717T:C |
Comments |
|
Polymerase used for cloning |
Platinum Taq HiFi
(Invitrogen) |
Fwd primer name |
SPBP8B7.14.Fd |
Fwd primer SEQ |
AAAAAGCAGGCTCTCATATGAACAATTCCATTACGGA |
Rev primer name |
SPBP8B7.14.Rv |
Rev primer SEQ |
AGAAAGCTGGGTAAATTCTCTCCTTGTGTGTA |
Amino acid length |
594 |
Molecular weight |
67.2 |
Isoelectric point (calc.) |
8.6 |
Signal SEQ |
|
No. of transmembrane domain |
|
NLS position (Columbia Univ.
Bioinformatics Center) |
none |
NES motif (
L-x(2,3)-[IVLMF]-x(2,3)-L-x-[LI]) |
LKALNNLDI |
Localization (YFP) |
nucleus>cytosol |
Comments for localization |
|
Effect of LMB on protein
localization |
no change |
Microscope used for
observation |
Leica |