| Gene name |
SPAC644.06c |
| Gene ID |
36/C10 |
| Gene synonyms/obsolete |
nim1; cdr1 |
| Gene product |
regulator of Wee1p
kinase; serine/threonine protein kinase; involved in mitosis
(induction); involved in the regulation of CDK activity |
| Entry clone |
Cloned |
| ORF length (unspliced) |
1782 |
| ORF length (spliced) |
|
| Entry clone length |
1782 |
| No. of intron |
0 |
| Sequence status |
Finished |
| Sequence results |
273T:C / 322T:C /
605T:C / 1580A:G / 1629A:G |
| Comments |
|
| Polymerase used for cloning |
Platinum Taq HiFi
(Invitrogen) |
| Fwd primer name |
SPAC644.06.Fd |
| Fwd primer SEQ |
AAAAAGCAGGCTCTCATATGGTGAAGCGACACAAAAA |
| Rev primer name |
SPAC644.06.Rv |
| Rev primer SEQ |
AGAAAGCTGGGTAATCCTTCCGAAAGAATGAA |
| Amino acid length |
593 |
| Molecular weight |
66.9 |
| Isoelectric point (calc.) |
8.1 |
| Signal SEQ |
|
| No. of transmembrane domain |
|
| NLS position (Columbia Univ.
Bioinformatics Center) |
none |
| NES motif (
L-x(2,3)-[IVLMF]-x(2,3)-L-x-[LI]) |
none |
| Localization (YFP) |
nucleus>=cytosol;
site of septum formation |
| Comments for localization |
nuclear dots by over
expression; cytoplasmic dots by over expression |
| Effect of LMB on protein
localization |
no change |
| Microscope used for
observation |
Leica,
DeltaVision |